Author: pmrpmr
Date: Jul 4, 2006 16:03
Dear Olivier,
> I try to make indexes for the release 87 of EMBL with new first line
> format:
>
> * I downloaded EMBOSS-3.0.0
>
> * gunzip, tar xvf ...
>
> * I replaced the files with the files in the fixes directory
There was a new fix last week for the embl87 format. As you see the
"emblnew" format, I assume you are using the latest fix.
> but when I try the seqret application I obtained this output:
>
>>.1; .1; Human cytomegalovirus strain AD169 complete genome
> gggccgcgtggtgggtcctcgaggggcgggggggtgtttttagcgggggggtgaaacttg
> gagttgcgtgtgtggacggcgactagttgcgtgtggtgcggaggacggcgacggcgaata
> aaagcgacgtgcggcgcgcacggcgaaaagaagacgcgtgtctgtgtctgtgtgattccc
> ...
|